0

I've got a .fasta file, which is strictly a formatted text containing some informations about DNA. Here's its common structure:

>NODE_18_length_75451_cov_83.3021
TGAACCGCTTGCCAAATATTTTCCGTCCGGACTTACGGCAACGGAAAGGAC
>NODE_3_length_175235_cov_84.0427
ACATGCAATGTTTATAGTCCTTGTATCAGAGACTCTATCAACGCTCTCGG

On even lines you've got the DNA sequence, and on odd lines you've got infos about the sequence. This scheme is repeated for at least 10k lines, into a single text file. I need to find a way to get only the value after "cov_" for every lines, to multiplicate it for 2 and print into a new file. The new file needs to have this scheme (for all the lines):

>NODE_18 cov_166.60
DNA seq: TGAACCGCTTGCCAAATATTTTCCGTCCGGACTTACGGCAACGGAAAGGAC
>NODE_3 cov_168.04
DNA seq: ACATGCAATGTTTATAGTCCTTGTATCAGAGACTCTATCAACGCTCTCGG  
2
  • Did you already tried something? Please post! Commented Feb 13, 2018 at 15:49
  • @JigglyNaga answer actually did the work. Tryin' to improve for doing the real task needed: when fixed, I'll update the quest with the code. Commented Feb 13, 2018 at 16:09

2 Answers 2

0

If you really want to use the shell for this, you can hand the arithmetic over to another command, like bc:

while read odd ; do
    echo -n "cov_" ; echo "2*${odd##*_}" | bc -q
    read even
    echo "DNA seq: $even"
done < input.fasta
6
  • It doesn't print actually what I'm looking for. "cov." value where cutted off in the output. Commented Feb 13, 2018 at 14:17
  • Sorry, I slipped up while renaming variables. Fixed. Commented Feb 13, 2018 at 14:40
  • can i grep letters from each even lines to calculate the % of G and C of every even line inside the loop? Tried as here, ( pastebin.com/Gb2w13dJ ) don't know why it doesn't work. Could you please give a look? Commented Feb 13, 2018 at 15:24
  • The shell runs this loop once for each pair of input lines; it can't backtrack, or read the same line again. If you add a grep (reading from stdin) into the loop, that will consume the whole of the rest of the file on the first run. You'd have to find some other way to count characters (which could be eg. echo $even | grep). Commented Feb 13, 2018 at 15:39
  • Updated. Seems to work, except for "Dna cont" : it stamps for every line "50%" which is, obviously, not correct. Could you give a look? pastebin.com/ZYcCwUVU Commented Feb 13, 2018 at 16:07
0

With bash? don't go there, it's not a text processing language. With awk:

awk -F_ '/^>/ {printf "%s_%s cov_%.2f\n", $1, $2, $6 * 2; next} {print "DNA seq:", $0}' file.fasta 
>NODE_18 cov_166.60
DNA seq: TGAACCGCTTGCCAAATATTTTCCGTCCGGACTTACGGCAACGGAAAGGAC
>NODE_3 cov_168.09
DNA seq: ACATGCAATGTTTATAGTCCTTGTATCAGAGACTCTATCAACGCTCTCGG
4
  • Is it possible to do more complex arithmetic operations into the printf argument? If I need to multiplicate and divide the $6 for other variables, did I need to do hand arithmetic over a "while..done" ? Commented Feb 13, 2018 at 14:08
  • @Shred printf arguments can be any valid expression AFAIK - beyond that, I'm unclear exactly what you're asking Commented Feb 13, 2018 at 14:13
  • In my case, for the cov. value i don't need to do just a *2 , but an operation where this value where divided for another variable (called, for example, K_MER). Could I do an operation like $6 / $K_MER into the printf argument? How can I use parenthesis to do that? Commented Feb 13, 2018 at 14:16
  • @Shred Arithmetic in awk follows the usual rules of operator precedence however $K_MER would refer to the field whose number is equal to the value of variable K_MER - for the value itself, drop the $ Commented Feb 13, 2018 at 15:14

You must log in to answer this question.

Start asking to get answers

Find the answer to your question by asking.

Ask question

Explore related questions

See similar questions with these tags.