Count the number of occurences of letters in a Python string

Question

So I got a DNA sequence.

ACCAGAGCGGCACAGCAGCGACATCAGCACTAGCACTAGCATCAGCATCAGCATCAGC
CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT
ACACCCCCCCCGGTGTGTGTGGGGGGTTAAAAATGATGAGTGATGAGTGAGTTGTGTG
CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT
TTCTATCATCATTCGGCGGGGGGATATATTATAGCGCGCGATTATTGCGCAGTCTACG
TCATCGACTACGATCAGCATCAGCATCAGCATCAGCATCGACTAGCATCAGCTACGAC

I need to count the bases.

Also for some reason it can sometimes it can alternate between upper or lowercase in the same string.

I think the question is perfectly fine. Even if it was homework, its an interesting problem. Why not ask it here ? +1 from me — lhk
– lhk, Commented Dec 2, 2012 at 12:07

Alex Martelli · Accepted Answer · 2009-11-15 19:00:05Z

7

for base in 'ACGT':
  print base, thesequence.count(base) + thesequence.count(base.lower())

answered Nov 15, 2009 at 19:00

Alex Martelli

887k175 gold badges1.3k silver badges1.4k bronze badges

Sign up to request clarification or add additional context in comments.

3 Comments

Edan Maor Over a year ago

Out of curiosity, is there a reason you don't do thesequence.lower().count(base.lower()), instead? I'm guessing it's to make it faster, but I'm not 100% sure.

sth Over a year ago

It's not necessarily faster this way, but it takes less memory. Since DNA sequences can be long this can be important.

Alex Martelli Over a year ago

Yep, as you need to do two passes anyway, it's better to have both be counting ones (memory-thrifty) rather than have one take up O(N) extra temporary memory. If you do have memory to spare, a single tmp = sequence.lower() outside the loop (then loop over 'acgt' in lowercase doing just tmp.count(base)) is going to be faster. A single pass with a finditer on a case-insensitive RE might be fastest, but a lot less simple than these approaches;-).

Collectives™ on Stack Overflow

Count the number of occurences of letters in a Python string

1 Answer 1

3 Comments

Your Answer

Hot Network Questions

Collectives™ on Stack Overflow

1 Answer 1

3 Comments

Your Answer

Sign up or log in

Post as a guest

Related