python regular expression specific characters, any combination

Question

So I'm trying to create a regex clause where it can detect any combination of 'ACTG' characters, and accept that as valid. While anything else - including a combination of 'ACTG' and some other characters are invalid.

Ultimately, I'll take it out of the while loop, that's just for testing purposes. Right now I believe as long as it starts with either a, c, t, or g, it says it's valid....

Is there a funcition in regex that would be better suited than match?

import re
while (True):
    DnaString = str(input('enter your polynucleotide chain code hooblah'))
    if (re.match('([ACTG]+[ACTG]*)', DnaString, flags=0)):
        #if re.search('^ACTG', DnaString) != -1: 
            print ("valid chain.")
    else: #(re.search('^[ACTG]+[ACTG]*$', DnaString) == -1):
        print("invalid chain, please check your input.")

    if (DnaString.find("end") != -1):
        print("ohokaybye.")
        break

Does you code do what you want it to do? Are you having trouble using match()? — RootTwo
– RootTwo, Commented Mar 8, 2016 at 4:00

BallpointBen · Accepted Answer · 2016-03-08 03:54:37Z

3

Why not just

if all(c in 'ACGT' for c in DnaString):
    # Do success
else:
    # Do failure

answered Mar 8, 2016 at 3:54

BallpointBen

15.6k2 gold badges46 silver badges81 bronze badges

Sign up to request clarification or add additional context in comments.

2 Comments

ddlem Over a year ago

so much simpler! thank you. all is still a reg ex function?

BallpointBen Over a year ago

all returns true if every value in the iterable (in this case, the generator (c in 'ACGT' for c in DnaString)) evaluates to true, otherwise it returns false.

Zhewriix · Accepted Answer · 2016-03-08 03:55:07Z

2

Your problem is that you are just searching for the ACTG characters anywhere in the string without specifying that nothing else is permitted. If you change your regex to ^[ACTG]+$ then it will work as expected. The ^ and $ characters are anchors which mean the start and end of the line, respectively.

So the regex above matches a string which contains one or more of the four characters and doesn't allow any other characters either before or after them.

answered Mar 8, 2016 at 3:55

Zhewriix

14810 bronze badges

3 Comments

ddlem Over a year ago

i had tried that in the beginning! let me try again. Thanks!

ddlem Over a year ago

edit: tried it, now works! not sure what changed in the middle. now i have : (re.match('^([ACTG]+[ACTG]*)$', DnaString, flags=0))

Zhewriix Over a year ago

That works, although the [ACTG]* isn't doing anything. The [ACTG]+ is a greedy match for one or more of the four characters, which means that it matches as many as possible. After it has matched as many as possible, the [ACTG]* tries to match zero or more characters, finds zero (since they've already been matched by +) and finishes. So ^([ACTG]+)$ would work just as well

Lincoln Lorscheider · Accepted Answer · 2016-03-08 03:55:42Z

1

If you allow a match to internally repeat acceptable characters, then this might be what you want:

'[A|C|T|G]{4}'

answered Mar 8, 2016 at 3:55

Lincoln Lorscheider

1426 bronze badges

1 Comment

ddlem Over a year ago

Thanks! this seems to do the same as what i have now. If it's in the first four indexes, then it works, but if another character is used later, it doesn't detect that it's invalid

Trenton McKinney · Accepted Answer · 2019-09-29 23:17:36Z

Without regular expressions:

Expanding on the original Code Only answer.
Use the membership operator, in
- Cretes a generator of True or False values
Use the built-in python function all
- Checks the generator, if they are all True, True is returned, otherwise False.
Use a generator expression, e.g. (base in bases for base in sequence)

bases = 'acgt'
sequence = (input('Input DNA sequence: ')).lower()

if all(base in bases for base in sequence):
    print('Input is correct')
else:
    print('Only allowed bases are A, T, C, G')

Output:

Input DNA sequence:  atcgggggcccccttttaaaa
Input is correct

Input DNA sequence:  atcgggggcccccttttaaaaf
Only allowed characters are A, T, C, G

Write a function:

Considering the length of a DNA sequence, realistically, noone is going to type one in.

def check_sequence(sequence: str):
    sequence = sequence.lower()
    bases = 'acgt'
    if all(base in bases for base in sequence):
        print('Input is correct')
    else:
        print('Only allowed characters are A, T, C, G')

my_sequence = 'gcaatgcAttGtgaaagagccGcTaCaacctaaacGctgcacgtcacctagagtgtCttgcgggTgaggccctctcgAacagattacagtaccgttatc'

check_sequence(my_sequence)

>>> Input is correct

Function that returns the sequence if it's not correct:

Use zip to combine iterables

def check_sequence(sequence: str) -> list:
    sequence = [base for base in sequence.lower()]
    base_pairs = 'acgt'
    matches = list(bases in base_pairs for bases in sequence)

    sequence_check = list(zip(sequence, matches))

    if all(matches):
        print('Input is correct')
    else:
        print('Only allowed characters are A, T, C, G')
        return sequence_check

Usage:

my_sequence = 'GcaatGcatfftgtgaaagAg'

verified_sequence = check_sequence(my_sequence)

print(verified_sequence)

# Output:
[('g', True),
 ('c', True),
 ('a', True),
 ('a', True),
 ('t', True),
 ('g', True),
 ('c', True),
 ('a', True),
 ('t', True),
 ('f', False),
 ('f', False),
 ('t', True),
 ('g', True),
 ('t', True),
 ('g', True),
 ('a', True),
 ('a', True),
 ('a', True),
 ('g', True),
 ('a', True),
 ('g', True)]

Collectives™ on Stack Overflow

python regular expression specific characters, any combination

4 Answers 4

2 Comments

3 Comments

1 Comment

Without regular expressions:

Output:

Write a function:

Function that returns the sequence if it's not correct:

Usage:

Comments

Your Answer

Hot Network Questions

Collectives™ on Stack Overflow

4 Answers 4

2 Comments

3 Comments

1 Comment

Without regular expressions:

Output:

Write a function:

Function that returns the sequence if it's not correct:

Usage:

Comments

Your Answer

Sign up or log in

Post as a guest

Related