Can I use strcmp without pointers?

Question

I have to make a program which takes a file of DNA sequences and a DNA subsequence from command arguments and find each time the subsequence and how many times it occurs. I'm having troubles with strcmp in line 36 and 42. Currently the way I have it I figured out through GDB that I am comparing the address of the strings and not the actual strings. But if I remove the & I get an error. I'm not sure what is the correct way to go about this is. TIA

#include <stdio.h>
#include <string.h>

int main(int argc, char *argv[]) {
    // place subsequence in string
    char *subsequence = argv[2];
    // get length of subsequence
    int seqLength = strlen(subsequence);
    // define file type and open for reading
    FILE *inputFile = fopen(argv[1], "r");
    // get each line using while loop
    char inputLine[200]; // string variable to store each line
    int i, j, lineLength, counter = 0, flag = -1;

    while (fgets(inputLine, 200, inputFile) != NULL) { // loop through each line
        lineLength = strlen(inputLine);

        for (i = 0; i < lineLength; i++) { // loop through each char in the line
            if (strcmp(&inputLine[i], &subsequence[0]) == 0) { 
            // if current char matches beginning of sequence loop through
            // each of the remaining chars and check them against 
            // corresponding chars in the sequence

                flag = 0;

                for (j = i + 1; j - i < seqLength; j++) {
                    if (strcmp(&inputLine[j], &subsequence[j - i]) != 0) {
                        flag = 1;
                        break;
                    }
                }

                if (flag == 0) {
                    counter++;
                }
            }
        }
    }

    fclose(inputFile);
    printf("%s appears %d time(s)\n", subsequence, counter);
    return 0;
}

dna.txt:

GGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTTCATGGTTCCCTGGCCC

input:

./dnaSearch dna.txt GTA

expected output:

GTA appears 2 times

Are you trying to compare strings or characters? Looks like characters to me. — Eugene Sh.
– Eugene Sh., Commented Nov 17, 2017 at 19:41
Then you don't need strcmp(). strcmp() compares zero-terminated strings (sequences of characters), characters just compare like the numbers they are. — dhke
– dhke, Commented Nov 17, 2017 at 19:44
BTW, if just char compares, you can just use == per character. — Michael Dorgan
– Michael Dorgan, Commented Nov 17, 2017 at 19:44
>>I am comparing the address of the strings and not the actual strings No, you are comparing the strings. &string[index] will fetch the substring from index to the end of the sting. — Killzone Kid
– Killzone Kid, Commented Nov 17, 2017 at 19:45
You should use strstr() to locate the substring, and observe a significant gain in speed for your app. — Michaël Roy
– Michaël Roy, Commented Nov 17, 2017 at 20:14

klutt · Accepted Answer · 2017-11-17 19:55:53Z

1

Just do like this:

if (inputLine[i] == subsequence[0]) {
    if (inputLine[j] != subsequence[j - i]) {

You do not need library functions to compare single characters.

answered Nov 17, 2017 at 19:55

klutt

31.7k19 gold badges65 silver badges114 bronze badges

Sign up to request clarification or add additional context in comments.

Comments

dbush · Accepted Answer · 2017-11-17 20:05:00Z

As others have mentioned, you don't need to call strcmp the first time since you're only checking a single character. You can just compare them directly:

if (inputLine[i] == subsequence[0]) {

However, there's a must simpler way of doing what you want. Since you're looking for a substring inside of another string, you can use the strstr function to do that:

while (fgets(inputLine, 200, inputFile) != NULL) { // loop through each line
    char *sub = inputLine;
    while ((sub = strstr(sub, subsequence) != NULL) {
        counter++;
        sub++;
    }
}

The strstr function will return a pointer inside the string to search of the substring that was found, or NULL if none was found. In the above code, if the substring is found the counter is incremented, then the substring pointer is moved up to continue the search.

vbarboza · Accepted Answer · 2017-11-17 20:10:34Z

1

Your string inputLine is a pointer to an array of characters and terminated in character '\0'.

strcmp expects a '\0' terminated string.

Passing &inputLine[i] is passing the address of character in position 'i' to the pointer argument and the string will be read until the '\0' character.

As suggested in the comments, you either use the ordinary operators to compare the strings characters:

if (inputLine[i] == subsequence[0]) {
    flag = 0;
    for (j = i + 1; j - i < seqLength; j++) {// loop
        if (inputLine[j] != subsequence[j - i]) {
            flag = 1;
            break;
        }
    }

Or use strncmp, which compares substrings:

if (strncmp(&inputLine[i], subsequence, seqLength) == 0) {
    counter++;
}

edited Nov 17, 2017 at 20:10

answered Nov 17, 2017 at 19:57

vbarboza

1659 bronze badges

Collectives™ on Stack Overflow

Can I use strcmp without pointers?

3 Answers 3

Comments

Comments

Comments

Your Answer

Hot Network Questions

Collectives™ on Stack Overflow

3 Answers 3

Comments

Comments

Comments

Your Answer

Sign up or log in

Post as a guest

Related