Sequence Count - Char in String java

Question

I have the following assignment: Count how many "runs" of the given character appear in the given string. A "run" is a consecutive block of one or more occurrences of the same character. For example, if the string is "AATGGGGCCGGTTGGGGGGGGGAAGC" and the character is "G", returns 4. No import, '?' is allowed My attempt:

public static int charRunCount(String str, char c){
    int counter = 0;
    for (int i = 0; i < str.length()-1; i++) {
        if ( (str.charAt (i) == str.charAt (i+1)) && str.charAt (i)==c )
            counter+=1;
    }
    return counter;
}

output =12, please help fix or correct.

Why should that input return 4? The longest run appears to be "GGGGGGGGG", I assume you should save and reset the counter which you get a non-matching letter. — Peter Lawrey
– Peter Lawrey, Commented Nov 2, 2018 at 11:59
I suppose you want the very first occurrence of the group for the reqd. char and not the other ones. If yes, then you should break the loop after the first group ends. — Abhishek Attri
– Abhishek Attri, Commented Nov 2, 2018 at 12:00
Try adding something like this within the if block: System.out.printf("%d, %d, %c", i, counter, str.charAt(i)); You'll then see the counter and character printed for each step of the loop. You'll quickly see what the problem is. — Emmanuel Rosa
– Emmanuel Rosa, Commented Nov 2, 2018 at 12:10

Peter Lawrey · Accepted Answer · 2018-11-02 12:03:52Z

5

You want to count the number of times a run of a particular character starts. The length of the run doesn't matter.

public static int charRunCount(String str, char c) {
    char last = 0;
    int counter = 0;
    for (int i = 0; i < str.length(); i++) {
        // whenever a run starts.
        if (last != c && str.charAt(i) == c)
            counter++;
        last = str.charAt(i);
    }
    return counter;
}

answered Nov 2, 2018 at 12:03

Peter Lawrey

535k83 gold badges770 silver badges1.2k bronze badges

Sign up to request clarification or add additional context in comments.

Collectives™ on Stack Overflow

Sequence Count - Char in String java

1 Answer 1

Comments

Your Answer

Hot Network Questions

Collectives™ on Stack Overflow

1 Answer 1

Comments

Your Answer

Sign up or log in

Post as a guest

Related